List of tablesTable2.1. Agarose gel (1%) Table 2.2. (TBE) Tris Borate Buffer EDTA (10X) Table 2.3. TBE(1X)Table 2.4. Gel loading dye (6X)Table 2.5. Ethidium bromide solutionTable 2.6. Allele-specific PCR primersTable 2.7. PCR reaction mix and cycling conditionsTable 2.8. PCR reaction mixtureTable 2.9. PCR of SNPs (total reaction volume 50 µl) Chapter 2: Materials and methods Table of materials 2.1. Agarose gel (1%) Serial No. Ingredient quantity (g/L)1 Agarose gel 12 TBE buffer (1X) 100 mlTable 2.2. (TBE) Tris Borate Buffer EDTA (10X) Serial No. Ingredient Amount (g/L)1 Tris Base 542 Boric Acid 27.53 0.5 M EDTA 20 ml 4 dH2O Up to 500 ml Table 2.3. TBE(1X)Serial Number Ingredient Quantity(ml/L)1 10X TBE 1002 dH2O 900mlTable 2.4. Gel Loading Stain (6X) Serial No. Ingredient Quantity1 Bromophenol Blue 0.025 g2 Xylene Cyanol 0.025 g3 Glycerol 3 ml4 dH2O 7 ml Total 10 mlTable 2.5. Ethidium Bromide Solution Serial Number Ingredient Quantity1 Ethidium Bromide 10 mg2 dH2O 1 ml Table 2.6. Allele specific PCR primers)rs9818870Sr n. Primer sequence dbSNP Base pair position Tm Ta Product1 F1.3 5'--- GCT GCTTGGTGCCTCTCTGATAC---3' C/T 61.5 61.2 667bp2 F2.3 5'--- GCTGCTTGGTGCCTCTCTGATAT ---3'C/T 60.4 61.2 667bp3 R3 5'--- CGAGGTAGGAACACAGCACA ---3'C/T 58.2 61.2 667bp ii)rs2258287 Sr n. Primer sequence dbSNP Base pair position Tm Ta Product1 F1.11 5'--- CGTCATGAAGGAGGCTTGATAACG ---3' G/T 58.8 578bp2 F2.11 5'--- CGTCATGAAGGAGGCTTGATAACT ---3' G/T 57.6 59.4 578bp3 R11 5 '--- ACTGCTCTTGGCAACAACCT---3'G/T 58.2 578bpTable 2.7. PCR reaction mixture and cycling conditions). Gradient PCRSerial no. Conc. chemical supplies Better... in the center of the paper... so that it does not damage the casting tray. The gel was poured into a gel pouring tray and the comb was inserted. The gel was left to solidify for about half an hour. The comb was removed and the tray was placed in the gel apparatus. The sample was prepared by mixing the DNA sample with loading dye in a 3:1 ratio (e.g., 3 µl of DNA sample was mixed with 1 µl of loading dye). Samples were loaded into the wells carefully by releasing the sample to the bottom of the well but taking care not to tear the well. The power was set to 100 or 80 V for genomic DNA and PCR products, respectively, and the gel was run until the dye reached two-thirds of the gel. The power was turned off and the gel was placed in staining solution for 15 min (5 µl ethidium bromide per 100 mL water). The gel was observed under UV light to see the position and intensity of the DNA bands.